SPIC cDNA ORF Clone, Human, N-HA tag

Cat: HG14038-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SPIC Reagents
CRO Services
Product recommended

All SPIC Reagents
SPIC cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Human Spi-C transcription factor (Spi-1/PU.1 related) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPIC cDNA ORF Clone, Human, N-HA tag Alternative Names
SPI-C cDNA ORF Clone, Human
SPIC Background Information
Full Name
Spi-C transcription factor (Spi-1/PU.1 related)

SPIC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPIC cDNA ORF Clone in Cloning Vector, Mouse MG53921-U
SPIC cDNA ORF Clone, Mouse, untagged MG53921-UT
SPIC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53921-ACG
SPIC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53921-ACGLN
SPIC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53921-ANG
SPIC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53921-ACR
SPIC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53921-ANR
SPIC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53921-CF
SPIC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53921-NF
SPIC cDNA ORF Clone, Mouse, C-His tag MG53921-CH
SPIC cDNA ORF Clone, Mouse, N-His tag MG53921-NH
SPIC cDNA ORF Clone, Mouse, C-HA tag MG53921-CY
SPIC cDNA ORF Clone, Mouse, N-HA tag MG53921-NY
SPIC cDNA ORF Clone, Mouse, C-Myc tag MG53921-CM
SPIC cDNA ORF Clone, Mouse, N-Myc tag MG53921-NM

SPIC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPIC cDNA ORF Clone in Cloning Vector, Human HG14038-G
SPIC cDNA ORF Clone, Human, untagged HG14038-UT
SPIC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14038-ACGLN
SPIC cDNA ORF Clone, Human, C-GFPSpark® tag HG14038-ACG
SPIC cDNA ORF Clone, Human, N-GFPSpark® tag HG14038-ANG
SPIC cDNA ORF Clone, Human, C-OFPSpark® tag HG14038-ACR
SPIC cDNA ORF Clone, Human, N-OFPSpark® tag HG14038-ANR
SPIC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14038-CF
SPIC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14038-NF
SPIC cDNA ORF Clone, Human, C-His tag HG14038-CH
SPIC cDNA ORF Clone, Human, N-His tag HG14038-NH
SPIC cDNA ORF Clone, Human, C-HA tag HG14038-CY
SPIC cDNA ORF Clone, Human, C-Myc tag HG14038-CM
SPIC cDNA ORF Clone, Human, N-Myc tag HG14038-NM
SPIC qPCR Primer Pairs, Human HP102694
info info
添加购物车成功! 添加购物车失败!