SSNA1 cDNA ORF Clone, Human, C-His tag

Cat: HG16344-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SSNA1 Reagents
CRO Services
Product recommended

All SSNA1 Reagents
SSNA1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Human Sjogren syndrome nuclear autoantigen 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SSNA1 cDNA ORF Clone, Human, C-His tag Alternative Names
N14 cDNA ORF Clone, Human;NA-14 cDNA ORF Clone, Human;NA14 cDNA ORF Clone, Human
SSNA1 Background Information
Full Name
Sjogren syndrome nuclear autoantigen 1

SSNA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SSNA1 cDNA ORF Clone in Cloning Vector, Mouse MG53448-U
SSNA1 cDNA ORF Clone, Mouse, untagged MG53448-UT
SSNA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53448-ACGLN
SSNA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53448-ACG
SSNA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53448-ANG
SSNA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53448-ACR
SSNA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53448-ANR
SSNA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53448-CF
SSNA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53448-NF
SSNA1 cDNA ORF Clone, Mouse, C-His tag MG53448-CH
SSNA1 cDNA ORF Clone, Mouse, N-His tag MG53448-NH
SSNA1 cDNA ORF Clone, Mouse, C-HA tag MG53448-CY
SSNA1 cDNA ORF Clone, Mouse, N-HA tag MG53448-NY
SSNA1 cDNA ORF Clone, Mouse, C-Myc tag MG53448-CM
SSNA1 cDNA ORF Clone, Mouse, N-Myc tag MG53448-NM

SSNA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SSNA1 cDNA ORF Clone in Cloning Vector, Human HG16344-G
SSNA1 cDNA ORF Clone, Human, untagged HG16344-UT
SSNA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16344-ACG
SSNA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16344-ACGLN
SSNA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16344-ANG
SSNA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16344-ACR
SSNA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16344-ANR
SSNA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16344-CF
SSNA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16344-NF
SSNA1 cDNA ORF Clone, Human, N-His tag HG16344-NH
SSNA1 cDNA ORF Clone, Human, C-HA tag HG16344-CY
SSNA1 cDNA ORF Clone, Human, N-HA tag HG16344-NY
SSNA1 cDNA ORF Clone, Human, C-Myc tag HG16344-CM
SSNA1 cDNA ORF Clone, Human, N-Myc tag HG16344-NM
SSNA1 qPCR Primer Pairs, Human HP105097
info info
添加购物车成功! 添加购物车失败!