휴먼 STIM1 Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 STIM1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_003156.3
    cDNA 크기:2058bp
    cDNA 설명:Full length Clone DNA of Homo sapiens stromal interaction molecule 1 with N terminal Myc tag.
    유전자 동의어:GOK, D11S4896E, STIM1
    :Human
    벡터:pCMV3-SP-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with STIM1 qPCR primers for gene expression analysis, HP101311 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I  membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains one EF-hand domain and one SAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+ influx following depletion of intracellular Ca2+ stores. It acts as Ca2+ sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+ depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+ release-activated Ca2+ (CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.

    참고자료
  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.
  • Size / Price
    Cat No: HG11434-NM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".