STIP1 cDNA ORF Clone, Human, C-HA tag

Cat: HG16371-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STIP1 Reagents

CRO Services

Product recommended


All STIP1 Reagents

STIP1 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Description
Full length Clone DNA of Human stress-induced phosphoprotein 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STIP1 cDNA ORF Clone, Human, C-HA tag Alternative Names

HEL-S-94n cDNA ORF Clone, Human;HOP cDNA ORF Clone, Human;IEF-SSP-3521 cDNA ORF Clone, Human;P60 cDNA ORF Clone, Human;STI1 cDNA ORF Clone, Human;STI1L cDNA ORF Clone, Human

STIP1 Background Information

Full Name
stress induced phosphoprotein 1

STIP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Rat RG80600-U
STIP1 cDNA ORF Clone, Rat, untagged RG80600-UT
STIP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80600-ACG
STIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80600-ACGLN
STIP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80600-ANG
STIP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80600-ACR
STIP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80600-ANR
STIP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80600-CF
STIP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80600-NF
STIP1 cDNA ORF Clone, Rat, C-His tag RG80600-CH
STIP1 cDNA ORF Clone, Rat, N-His tag RG80600-NH
STIP1 cDNA ORF Clone, Rat, C-HA tag RG80600-CY
STIP1 cDNA ORF Clone, Rat, N-HA tag RG80600-NY
STIP1 cDNA ORF Clone, Rat, C-Myc tag RG80600-CM
STIP1 cDNA ORF Clone, Rat, N-Myc tag RG80600-NM
STIP1 qPCR Primer Pairs, Rat RP300564

STIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Mouse MG52725-U
STIP1 cDNA ORF Clone, Mouse, untagged MG52725-UT
STIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52725-ACGLN
STIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52725-ACG
STIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52725-ANG
STIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52725-ACR
STIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52725-ANR
STIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52725-CF
STIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52725-NF
STIP1 cDNA ORF Clone, Mouse, C-His tag MG52725-CH
STIP1 cDNA ORF Clone, Mouse, N-His tag MG52725-NH
STIP1 cDNA ORF Clone, Mouse, C-HA tag MG52725-CY
STIP1 cDNA ORF Clone, Mouse, N-HA tag MG52725-NY
STIP1 cDNA ORF Clone, Mouse, C-Myc tag MG52725-CM
STIP1 cDNA ORF Clone, Mouse, N-Myc tag MG52725-NM
STIP1 qPCR Primer Pairs, Mouse MP202596

STIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Human HG16371-G
STIP1 cDNA ORF Clone, Human, untagged HG16371-UT
STIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16371-ACGLN
STIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16371-ACG
STIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16371-ANG
STIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16371-ACR
STIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16371-ANR
STIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16371-CF
STIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16371-NF
STIP1 cDNA ORF Clone, Human, C-His tag HG16371-CH
STIP1 cDNA ORF Clone, Human, N-His tag HG16371-NH
STIP1 cDNA ORF Clone, Human, N-HA tag HG16371-NY
STIP1 cDNA ORF Clone, Human, C-Myc tag HG16371-CM
STIP1 cDNA ORF Clone, Human, N-Myc tag HG16371-NM
STIP1 qPCR Primer Pairs, Human HP105121
info info
添加购物车成功! 添加购物车失败!