After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 OPN/Osteopontin Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human SPP1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001040058.1
cDNA 크기:945bp
cDNA 설명:Full length Clone DNA of Homo sapiens secreted phosphoprotein 1, transcript variant 1 with C terminal Flag tag.
유전자 동의어:OPN, BNSP, BSPI, ETA-1, MGC110940
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-SPP1-Flag
제한 사이트:KpnI + XbaI (6kb + 1kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human SPP1 Gene Plasmid Map
Human Spp1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human SPP1 Gene Expression validated Image
Human Spp1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag
[이미지를 확대하려면 클릭]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

참고자료
  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Cat No: HG10352-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human Spp1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag
    • Human Spp1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".