After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human TBCA cDNA 클론 제품 정보
Gene_bank_ref_id:BC018210
cDNA 크기:327bp
cDNA 설명:Full length Clone DNA of Homo sapiens tubulin folding cofactor A with C terminal Flag tag.
유전자 동의어:TBCA
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13918-ACG265260
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13918-ACR265260
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13918-ANG265260
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13918-ANR265260
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13918-CF229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-His 태그HG13918-CH229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13918-CM229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, C-HA 태그HG13918-CY229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone in cloning vectorHG13918-G88420
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13918-NF229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-His 태그HG13918-NH229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13918-NM229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmid, N-HA 태그HG13918-NY229890
휴먼 Tubulin folding cofactor A Gene ORF cDNA clone expression plasmidHG13918-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

참고자료
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Cat No: HG13918-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".