After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 TCN2 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human TCN2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000355.2
cDNA 크기:1284bp
cDNA 설명:Full length Clone DNA of Homo sapiens transcobalamin II; macrocytic anemia with N terminal Flag tag.
유전자 동의어:TC2, D22S676, D22S750
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-TCN2
제한 사이트:KpnI + XbaI (6kb + 1.32kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human TCN2 Gene Plasmid Map
Human TCN2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Transcobalamin II, also known as TCN2 and TC II, is a plasma protein that binds cobalamin (Cbl; vitamin B12) as it is absorbed in the terminal ileum and distributes to tissues. The circulating transcobalamin II-cobalamin complex binds to receptors on the plasma membrane of tissue cells and is then internalized by receptor-mediated endocytosis. Transcobalamin II is a non-glycolated secretory protein of molecular mass 43 kDa. Its plasma membrane receptor (TC II-R) is a heavily glycosylated protein with a monomeric molecular mass of 62 kDa. Human TCN2 gene is composed of nine exons and eight introns spanning approximately 20 kb with multiple potential transcription start sites. A number of genetic abnormalities are characterized either by a failure to express TCN2 or by synthesis of an abnormal protein. The TCN2 deficiency results in cellular cobalamin deficiency, an early onset of megaloblastic anaemia, and neurological abnormalities.

참고자료
  • Rothenberg, S. P. et al., 1995, Baillieres Clin Haematol. 8 (3):499-514.
  • Bibi, H. et al., 1999, J Inherit Metab Dis. 22 (7):765-772.
  • Seetharam,B. et al.,2000, Vitam Horm. 59 :337-366. 
  • Size / Price
    Cat No: HG10566-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human TCN2 natural ORF mammalian expression plasmid, N-Flag tag
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".