Transferrin cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Transferrin cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2097 bp
Description
Full length Clone DNA of Human transferrin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Transferrin cDNA ORF Clone, Human, N-Myc tag: Alternative Names

HEL-S-71p cDNA ORF Clone, Human; PRO1557 cDNA ORF Clone, Human; PRO2086 cDNA ORF Clone, Human; TFQTL1 cDNA ORF Clone, Human; Transferrin cDNA ORF Clone, Human

Transferrin Background Information

Transferrin is a glycoprotein with an approximate molecular weight of 76.5 kDa. This glycoprotein is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of Transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte / pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. Transferrins are iron binding transport proteins which bind Fe3+ ion in association with the binding of an anion, usually bicarbonate. This transferrin binds only one Fe3+ ion per protein molecule. Transports iron ions from the hemolymph into the eggs during the vitellogenic stage. Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation. When a transferrin loaded with iron encounters with a transferring receptor on cell surface, transferring binds to it and, as a consequence, is transported into the cell in a visicle by receptor-mediated endocytosis. The PH is reduced by hydrogen iron pumps. The lower pH causes transferrin to release its iron ions. The receptor is then transported through the endocytic cycle back to the cell surface, ready for another round of iron uptake. Each transferrin molecule has the ability to carry two iron ions in the ferric form.
Full Name
transferrin
References
  • Ponka P, et al. (1998) Function and regulation of transferrin and ferritin. Semin Hematol. 35(1): 35-54.
  • Wagner E, et al. (1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci. 87(9): 3410-4.
  • Cheng Y, et al. (2004) Structure of the human transferrin receptor-transferrin complex. Cell. 116 (4): 565-76.

Transferrin cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait