TMEM134 cDNA ORF Clone, Human, C-His tag

Cat: HG13393-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TMEM134 Reagents

CRO Services

Product recommended


All TMEM134 Reagents

TMEM134 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Human transmembrane protein 134 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM134 Background Information

Full Name
transmembrane protein 134

TMEM134 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM134 cDNA ORF Clone in Cloning Vector, Mouse MG53550-G
TMEM134 cDNA ORF Clone, Mouse, untagged MG53550-UT
TMEM134 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53550-ACGLN
TMEM134 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53550-ACG
TMEM134 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53550-ACR
TMEM134 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53550-CF
TMEM134 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53550-NF
TMEM134 cDNA ORF Clone, Mouse, C-His tag MG53550-CH
TMEM134 cDNA ORF Clone, Mouse, N-His tag MG53550-NH
TMEM134 cDNA ORF Clone, Mouse, C-HA tag MG53550-CY
TMEM134 cDNA ORF Clone, Mouse, N-HA tag MG53550-NY
TMEM134 cDNA ORF Clone, Mouse, C-Myc tag MG53550-CM
TMEM134 cDNA ORF Clone, Mouse, N-Myc tag MG53550-NM

TMEM134 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM134 cDNA ORF Clone in Cloning Vector, Human HG13393-G
TMEM134 cDNA ORF Clone, Human, untagged HG13393-UT
TMEM134 cDNA ORF Clone, Human, C-GFPSpark® tag HG13393-ACG
TMEM134 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13393-ACGLN
TMEM134 cDNA ORF Clone, Human, C-OFPSpark® tag HG13393-ACR
TMEM134 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13393-CF
TMEM134 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13393-NF
TMEM134 cDNA ORF Clone, Human, N-His tag HG13393-NH
TMEM134 cDNA ORF Clone, Human, C-HA tag HG13393-CY
TMEM134 cDNA ORF Clone, Human, N-HA tag HG13393-NY
TMEM134 cDNA ORF Clone, Human, C-Myc tag HG13393-CM
TMEM134 cDNA ORF Clone, Human, N-Myc tag HG13393-NM
TMEM134 qPCR Primer Pairs, Human HP102097
info info
添加购物车成功! 添加购物车失败!