TMOD2 cDNA ORF Clone, Human, untagged

Cat: HG15256-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMOD2 Reagents
CRO Services
Product recommended

All TMOD2 Reagents
TMOD2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Human tropomodulin 2 (neuronal).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMOD2 cDNA ORF Clone, Human, untagged Alternative Names
N-TMOD cDNA ORF Clone, Human;NTMOD cDNA ORF Clone, Human
TMOD2 Background Information
Full Name
tropomodulin 2 (neuronal)

TMOD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMOD2 cDNA ORF Clone in Cloning Vector, Mouse MG52019-G
TMOD2 cDNA ORF Clone, Mouse, untagged MG52019-UT
TMOD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52019-ACGLN
TMOD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52019-ACG
TMOD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52019-ANG
TMOD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52019-ACR
TMOD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52019-ANR
TMOD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52019-CF
TMOD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52019-NF
TMOD2 cDNA ORF Clone, Mouse, C-His tag MG52019-CH
TMOD2 cDNA ORF Clone, Mouse, N-His tag MG52019-NH
TMOD2 cDNA ORF Clone, Mouse, C-HA tag MG52019-CY
TMOD2 cDNA ORF Clone, Mouse, N-HA tag MG52019-NY
TMOD2 cDNA ORF Clone, Mouse, C-Myc tag MG52019-CM
TMOD2 cDNA ORF Clone, Mouse, N-Myc tag MG52019-NM
TMOD2 qPCR Primer Pairs, Mouse MP201892

TMOD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMOD2 cDNA ORF Clone in Cloning Vector, Human HG15256-G
TMOD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15256-ACG
TMOD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15256-ACGLN
TMOD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15256-ANG
TMOD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15256-ACR
TMOD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15256-ANR
TMOD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15256-CF
TMOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15256-NF
TMOD2 cDNA ORF Clone, Human, C-His tag HG15256-CH
TMOD2 cDNA ORF Clone, Human, N-His tag HG15256-NH
TMOD2 cDNA ORF Clone, Human, C-HA tag HG15256-CY
TMOD2 cDNA ORF Clone, Human, N-HA tag HG15256-NY
TMOD2 cDNA ORF Clone, Human, C-Myc tag HG15256-CM
TMOD2 cDNA ORF Clone, Human, N-Myc tag HG15256-NM
TMOD2 qPCR Primer Pairs, Human HP103882
info info
添加购物车成功! 添加购物车失败!