RANK cDNA ORF Clone, Human, N-Myc tag

Cat: HG16078-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RANK Reagents
CRO Services
Product recommended

All RANK Reagents
RANK cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1851 bp
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 11a, NFKB activator with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RANK cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD265 cDNA ORF Clone, Human;FEO cDNA ORF Clone, Human;LOH18CR1 cDNA ORF Clone, Human;ODFR cDNA ORF Clone, Human;OFE cDNA ORF Clone, Human;OPTB7 cDNA ORF Clone, Human;OSTS cDNA ORF Clone, Human;PDB2 cDNA ORF Clone, Human;RANK cDNA ORF Clone, Human;TNFRSF11A cDNA ORF Clone, Human;TRANCER cDNA ORF Clone, Human
RANK Background Information

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.

Full Name
tumor necrosis factor receptor superfamily member 11a
References
  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
  • RANK cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Rat RG80160-G
    RANK cDNA ORF Clone, Rat, untagged RG80160-UT
    RANK cDNA ORF Clone, Rat, C-GFPSpark® tag RG80160-ACG
    RANK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80160-ACGLN
    RANK cDNA ORF Clone, Rat, C-OFPSpark® tag RG80160-ACR
    RANK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80160-CF
    RANK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80160-NF
    RANK cDNA ORF Clone, Rat, C-His tag RG80160-CH
    RANK cDNA ORF Clone, Rat, N-His tag RG80160-NH
    RANK cDNA ORF Clone, Rat, C-HA tag RG80160-CY
    RANK cDNA ORF Clone, Rat, N-HA tag RG80160-NY
    RANK cDNA ORF Clone, Rat, C-Myc tag RG80160-CM
    RANK cDNA ORF Clone, Rat, N-Myc tag RG80160-NM
    RANK qPCR Primer Pairs, Rat RP300155

    RANK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Mouse MG50490-M
    RANK cDNA ORF Clone, Mouse, untagged MG50490-UT
    RANK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50490-ACG
    RANK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50490-ACGLN
    RANK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50490-ACR
    RANK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50490-CF
    RANK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50490-NF
    RANK cDNA ORF Clone, Mouse, C-His tag MG50490-CH
    RANK cDNA ORF Clone, Mouse, N-His tag MG50490-NH
    RANK cDNA ORF Clone, Mouse, C-HA tag MG50490-CY
    RANK cDNA ORF Clone, Mouse, N-HA tag MG50490-NY
    RANK cDNA ORF Clone, Mouse, C-Myc tag MG50490-CM
    RANK cDNA ORF Clone, Mouse, N-Myc tag MG50490-NM
    RANK qPCR Primer Pairs, Mouse MP200484

    RANK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Human HG16078-G
    RANK cDNA ORF Clone, Human, untagged HG16078-UT
    RANK cDNA ORF Clone, Human, C-GFPSpark® tag HG16078-ACG
    RANK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16078-ACGLN
    RANK cDNA ORF Clone, Human, C-OFPSpark® tag HG16078-ACR
    RANK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16078-CF
    RANK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16078-NF
    RANK cDNA ORF Clone, Human, C-His tag HG16078-CH
    RANK cDNA ORF Clone, Human, N-His tag HG16078-NH
    RANK cDNA ORF Clone, Human, C-HA tag HG16078-CY
    RANK cDNA ORF Clone, Human, N-HA tag HG16078-NY
    RANK cDNA ORF Clone, Human, C-Myc tag HG16078-CM
    info info
    添加购物车成功! 添加购物车失败!