BAFF R cDNA ORF Clone, Human, N-Myc tag

Cat: HG16079-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BAFF R Reagents

CRO Services

Product recommended


All BAFF R Reagents

BAFF R cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 13C with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAFF R cDNA ORF Clone, Human, N-Myc tag Alternative Names

BAFF-R cDNA ORF Clone, Human;BAFFR cDNA ORF Clone, Human;BROMIX cDNA ORF Clone, Human;CD268 cDNA ORF Clone, Human;CVID4 cDNA ORF Clone, Human;prolixin cDNA ORF Clone, Human

BAFF R Background Information

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

Full Name
tumor necrosis factor receptor superfamily, member 13C
References
  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • BAFF R cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BAFF R cDNA ORF Clone in Cloning Vector, Rat RG80171-G
    BAFF R cDNA ORF Clone, Rat, untagged RG80171-UT
    BAFF R cDNA ORF Clone, Rat, C-GFPSpark® tag RG80171-ACG
    BAFF R Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80171-ACGLN
    BAFF R cDNA ORF Clone, Rat, C-OFPSpark® tag RG80171-ACR
    BAFF R cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80171-CF
    BAFF R cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80171-NF
    BAFF R cDNA ORF Clone, Rat, C-His tag RG80171-CH
    BAFF R cDNA ORF Clone, Rat, N-His tag RG80171-NH
    BAFF R cDNA ORF Clone, Rat, C-HA tag RG80171-CY
    BAFF R cDNA ORF Clone, Rat, N-HA tag RG80171-NY
    BAFF R cDNA ORF Clone, Rat, C-Myc tag RG80171-CM
    BAFF R cDNA ORF Clone, Rat, N-Myc tag RG80171-NM
    BAFF R qPCR Primer Pairs, Rat RP300164

    BAFF R cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BAFF R cDNA ORF Clone in Cloning Vector, Mouse MG50353-M
    BAFF R cDNA ORF Clone, Mouse, untagged MG50353-UT
    BAFF R Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50353-ACGLN
    BAFF R cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50353-ACG
    BAFF R cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50353-ACR
    BAFF R cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50353-CF
    BAFF R cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50353-NF
    BAFF R cDNA ORF Clone, Mouse, C-His tag MG50353-CH
    BAFF R cDNA ORF Clone, Mouse, N-His tag MG50353-NH
    BAFF R cDNA ORF Clone, Mouse, C-HA tag MG50353-CY
    BAFF R cDNA ORF Clone, Mouse, N-HA tag MG50353-NY
    BAFF R cDNA ORF Clone, Mouse, C-Myc tag MG50353-CM
    BAFF R cDNA ORF Clone, Mouse, N-Myc tag MG50353-NM
    BAFF R qPCR Primer Pairs, Mouse MP200374

    BAFF R cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BAFF R cDNA ORF Clone in Cloning Vector, Human HG16079-G
    BAFF R cDNA ORF Clone, Human, untagged HG16079-UT
    BAFF R Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16079-ACGLN
    BAFF R cDNA ORF Clone, Human, C-GFPSpark® tag HG16079-ACG
    BAFF R cDNA ORF Clone, Human, C-OFPSpark® tag HG16079-ACR
    BAFF R cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16079-CF
    BAFF R cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16079-NF
    BAFF R cDNA ORF Clone, Human, C-His tag HG16079-CH
    BAFF R cDNA ORF Clone, Human, N-His tag HG16079-NH
    BAFF R cDNA ORF Clone, Human, C-HA tag HG16079-CY
    BAFF R cDNA ORF Clone, Human, N-HA tag HG16079-NY
    BAFF R cDNA ORF Clone, Human, C-Myc tag HG16079-CM
    info info
    添加购物车成功! 添加购物车失败!