TNFSF18 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16080-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TNFSF18 Reagents
CRO Services
Product recommended

All TNFSF18 Reagents
TNFSF18 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNFSF18 cDNA ORF Clone, Human, N-Myc tag Alternative Names
AITRL cDNA ORF Clone, Human;GITRL cDNA ORF Clone, Human;hGITRL cDNA ORF Clone, Human;TL6 cDNA ORF Clone, Human
TNFSF18 Background Information

The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.

Immune Checkpoint
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 18
References
  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
  • TNFSF18 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TNFSF18 cDNA ORF Clone in Cloning Vector, Mouse MG58758-G
    TNFSF18 cDNA ORF Clone, Mouse, untagged MG58758-UT
    TNFSF18 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58758-ACG
    TNFSF18 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58758-ACGLN
    TNFSF18 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58758-ACR
    TNFSF18 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58758-CF
    TNFSF18 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58758-NF
    TNFSF18 cDNA ORF Clone, Mouse, C-His tag MG58758-CH
    TNFSF18 cDNA ORF Clone, Mouse, N-His tag MG58758-NH
    TNFSF18 cDNA ORF Clone, Mouse, C-HA tag MG58758-CY
    TNFSF18 cDNA ORF Clone, Mouse, N-HA tag MG58758-NY
    TNFSF18 cDNA ORF Clone, Mouse, C-Myc tag MG58758-CM
    TNFSF18 cDNA ORF Clone, Mouse, N-Myc tag MG58758-NM

    TNFSF18 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TNFSF18 cDNA ORF Clone in Cloning Vector, Human HG16080-G
    TNFSF18 cDNA ORF Clone, Human, untagged HG13058-UT
    TNFSF18 cDNA ORF Clone, Human, untagged HG16080-UT
    TNFSF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16080-ACGLN
    TNFSF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13058-ACGLN
    TNFSF18 cDNA ORF Clone, Human, C-GFPSpark® tag HG16080-ACG
    TNFSF18 cDNA ORF Clone, Human, C-OFPSpark® tag HG16080-ACR
    TNFSF18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16080-CF
    TNFSF18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16080-NF
    TNFSF18 cDNA ORF Clone, Human, C-His tag HG16080-CH
    TNFSF18 cDNA ORF Clone, Human, N-His tag HG16080-NH
    TNFSF18 cDNA ORF Clone, Human, C-HA tag HG16080-CY
    TNFSF18 cDNA ORF Clone, Human, N-HA tag HG16080-NY
    TNFSF18 cDNA ORF Clone, Human, C-Myc tag HG16080-CM
    TNFSF18 qPCR Primer Pairs, Human HP104622
    info info
    添加购物车成功! 添加购物车失败!