TOMM20 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15094-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOMM20 Reagents
CRO Services
Product recommended

All TOMM20 Reagents
TOMM20 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Human translocase of outer mitochondrial membrane 20 homolog (yeast) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOMM20 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
MAS20 cDNA ORF Clone, Human;MOM19 cDNA ORF Clone, Human;TOM20 cDNA ORF Clone, Human
TOMM20 Background Information
Full Name
translocase of outer mitochondrial membrane 20 homolog (yeast)

TOMM20 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TOMM20 cDNA ORF Clone in Cloning Vector, Rat RG83618-U
TOMM20 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83618-ACGLN

TOMM20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOMM20 cDNA ORF Clone in Cloning Vector, Mouse MG5A1569-U
TOMM20 cDNA ORF Clone, Mouse, untagged MG5A1569-UT
TOMM20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1569-ACG
TOMM20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1569-ACGLN
TOMM20 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1569-ANG
TOMM20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1569-ACR
TOMM20 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1569-ANR
TOMM20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1569-CF
TOMM20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1569-NF
TOMM20 cDNA ORF Clone, Mouse, C-His tag MG5A1569-CH
TOMM20 cDNA ORF Clone, Mouse, N-His tag MG5A1569-NH
TOMM20 cDNA ORF Clone, Mouse, C-HA tag MG5A1569-CY
TOMM20 cDNA ORF Clone, Mouse, N-HA tag MG5A1569-NY
TOMM20 cDNA ORF Clone, Mouse, C-Myc tag MG5A1569-CM
TOMM20 cDNA ORF Clone, Mouse, N-Myc tag MG5A1569-NM

TOMM20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOMM20 cDNA ORF Clone in Cloning Vector, Human HG15094-G
TOMM20 cDNA ORF Clone, Human, untagged HG15094-UT
TOMM20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15094-ACGLN
TOMM20 cDNA ORF Clone, Human, C-GFPSpark® tag HG15094-ACG
TOMM20 cDNA ORF Clone, Human, N-GFPSpark® tag HG15094-ANG
TOMM20 cDNA ORF Clone, Human, C-OFPSpark® tag HG15094-ACR
TOMM20 cDNA ORF Clone, Human, N-OFPSpark® tag HG15094-ANR
TOMM20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15094-NF
TOMM20 cDNA ORF Clone, Human, C-His tag HG15094-CH
TOMM20 cDNA ORF Clone, Human, N-His tag HG15094-NH
TOMM20 cDNA ORF Clone, Human, C-HA tag HG15094-CY
TOMM20 cDNA ORF Clone, Human, N-HA tag HG15094-NY
TOMM20 cDNA ORF Clone, Human, C-Myc tag HG15094-CM
TOMM20 cDNA ORF Clone, Human, N-Myc tag HG15094-NM
TOMM20 qPCR Primer Pairs, Human HP103721
info info
添加购物车成功! 添加购物车失败!