휴먼 TPI1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
휴먼 TPI1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000365.5
cDNA 크기:750bp
cDNA 설명:Full length Clone DNA of Homo sapiens triosephosphate isomerase 1.
유전자 동의어:TIM, TPI, TPID, HEL-S-49
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TPI1 qPCR primers for gene expression analysis, HP104919 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".