TPRKB cDNA ORF Clone, Human, N-Myc tag

Cat: HG11442-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TPRKB Reagents
CRO Services
Product recommended

All TPRKB Reagents
TPRKB cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Human TP53RK binding protein with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPRKB cDNA ORF Clone, Human, N-Myc tag Alternative Names
CGI-121 cDNA ORF Clone, Human
TPRKB Background Information
Full Name
TP53RK binding protein

TPRKB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TPRKB cDNA ORF Clone in Cloning Vector, Mouse MG5A4969-U
TPRKB cDNA ORF Clone, Mouse, untagged MG5A4969-UT
TPRKB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4969-ACG
TPRKB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4969-ACGLN
TPRKB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4969-ANG
TPRKB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4969-ACR
TPRKB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4969-ANR
TPRKB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4969-CF
TPRKB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4969-NF
TPRKB cDNA ORF Clone, Mouse, C-His tag MG5A4969-CH
TPRKB cDNA ORF Clone, Mouse, N-His tag MG5A4969-NH
TPRKB cDNA ORF Clone, Mouse, C-HA tag MG5A4969-CY
TPRKB cDNA ORF Clone, Mouse, N-HA tag MG5A4969-NY
TPRKB cDNA ORF Clone, Mouse, C-Myc tag MG5A4969-CM
TPRKB cDNA ORF Clone, Mouse, N-Myc tag MG5A4969-NM

TPRKB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPRKB cDNA ORF Clone in Cloning Vector, Human HG11442-M
TPRKB cDNA ORF Clone, Human, untagged HG11442-UT
TPRKB cDNA ORF Clone, Human, C-GFPSpark® tag HG11442-ACG
TPRKB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11442-ACGLN
TPRKB cDNA ORF Clone, Human, N-GFPSpark® tag HG11442-ANG
TPRKB cDNA ORF Clone, Human, C-OFPSpark® tag HG11442-ACR
TPRKB cDNA ORF Clone, Human, N-OFPSpark® tag HG11442-ANR
TPRKB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11442-CF
TPRKB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11442-NF
TPRKB cDNA ORF Clone, Human, C-His tag HG11442-CH
TPRKB cDNA ORF Clone, Human, N-His tag HG11442-NH
TPRKB cDNA ORF Clone, Human, C-HA tag HG11442-CY
TPRKB cDNA ORF Clone, Human, N-HA tag HG11442-NY
TPRKB cDNA ORF Clone, Human, C-Myc tag HG11442-CM
TPRKB qPCR Primer Pairs, Human HP101319
info info
添加购物车成功! 添加购物车失败!