After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 TREML2/TLT-2 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human TREML2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_024807.2
cDNA 크기:966bp
cDNA 설명:Full length Clone DNA of Homo sapiens triggering receptor expressed on myeloid cells-like 2 with C terminal Flag tag.
유전자 동의어:TLT2, C6orf76, FLJ13693, MGC149715, MGC149716, dJ238O23.1, TREML2
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I  membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

참고자료
  • Mungall A.J. et al., 2003, Nature. 425: 805-11.
  • Clark HF. et al., 2003, Genome Res. 13: 2265-70.
  • The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.
  • Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.
  • Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.
  • Size / Price
    Cat No: HG11655-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".