After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Thioredoxin-2/TXN2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human TXN2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC013726
cDNA 크기:501bp
cDNA 설명:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
유전자 동의어:MTRX, TRX2, MT-TRX
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

참고자료
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Cat No: HG12557-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".