휴먼 Thioredoxin-2/TXN2 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 TXN2 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC013726
    cDNA 크기:501bp
    cDNA 설명:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
    유전자 동의어:MTRX, TRX2, MT-TRX
    :Human
    벡터:pCMV3-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TXN2 qPCR primers for gene expression analysis, HP104573 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

    참고자료
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Cat No: HG12557-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".