휴먼 TRP1 / TYRP1 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 TYRP1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_000550.2
    cDNA 크기:1614bp
    cDNA 설명:Full length Clone DNA of Homo sapiens tyrosinase-related protein 1 with N terminal His tag.
    유전자 동의어:TRP, CAS2, CATB, GP75, TYRP, b-PROTEIN, TYRP1
    :Human
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TYRP1 qPCR primers for gene expression analysis, HP102195 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    Tyrosinase-related protein 1, also known as TYRP1 or TRP1, is a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Mutations in this enzyme are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. TYRP1 / TRP1 is involved in the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid. This enzyme may regulate or influence the type of melanin synthesized. The expression of Tyrosinase-related protein 1 (TYRP1) is regulated by the microphthalmia-associated transcription factor (MITF). There is mounting evidence demonstrating that in addition to its role in eumelanin synthesis, TYRP1 is involved in maintaining stability of tyrosinase proliferation and melanocyte cell death.

    참고자료
  • Sarangarajan R, et al. (2001) Tyrp1 and oculocutaneous albinism type 3. Pigment Cell Res. 14(6): 437-44.
  • Box NF, et al. (1998) Complete sequence and polymorphism study of the human TYRP1 gene encoding tyrosinase-related protein 1. Genome. 9 (1): 50-3.
  • Size / Price
    Cat No: HG13224-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".