Tie-1 cDNA ORF Clone, Human, N-HA tag

Cat: HG10509-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Tie-1 Reagents

CRO Services

Product recommended


All Tie-1 Reagents

Tie-1 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
3417 bp
Description
Full length Clone DNA of Human tyrosine kinase with immunoglobulin-like and EGF-like domains 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tie-1 cDNA ORF Clone, Human, N-HA tag Alternative Names

JTK14 cDNA ORF Clone, Human;TIE cDNA ORF Clone, Human

Tie-1 Background Information

Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 also known as Tie1 is an angiopoietin receptor and is an orphan receptor tyrosine kinase that is expressed almost exclusively in endothelial cells and that is required for normal embryonic vascular development. The receptor tyrosine kinase Tie1 is expressed primarily in vascular endothelial cells. The receptor has also been detected in epithelial tumours in breast, thyroid and gastric cancers and in tumour cell lines where it appears as a 45 kDa truncated receptor fragment. Tie1 promotes endothelial cell survival, but other studies have suggested that the Tie1 kinase has little to no activity. Embryos deficient in Tie1 failed to establish structural integrity of vascular endothelial cells, resulting in oedema and subsequently localized haemorrhage. Tie1 is significantly higher in human aortic endothelial cells than in human umbilical vein endothelial cells. Additionally, attachment of cells of monocytic lineage to endothelial cells is also enhanced by Tie1 expression. Collectively Tie1 has a proinflammatory property and may play a role in the endothelial inflammatory diseases such as atherosclerosis.

Full Name
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
References
  • Chan B, et al. (2008) Receptor tyrosine kinase Tie-1 overexpression in endothelial cells upregulates adhesion molecules. Biochem Biophys Res Commun. 371(3): 475-9.
  • Sato TN, et al. (1995) Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature. 376(6535): 70-4.
  • Rees KA, et al. (2007) The receptor tyrosine kinase Tie1 is expressed and activated in epithelial tumour cell lines. Int J Oncol. 31(4): 893-7.
  • Kontos CD, et al. (2002) The endothelial receptor tyrosine kinase Tie1 activates phosphatidylinositol 3-kinase and Akt to inhibit apoptosis. Mol Cell Biol. 22(6): 1704-13.
  • info info
    添加购物车成功! 添加购物车失败!