UBE2D1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11432-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All UBE2D1 Reagents

CRO Services

Product recommended


All UBE2D1 Reagents

UBE2D1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2D1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

E2(17)KB1 cDNA ORF Clone, Human;SFT cDNA ORF Clone, Human;UBC4/5 cDNA ORF Clone, Human;UBCH5 cDNA ORF Clone, Human;UBCH5A cDNA ORF Clone, Human

UBE2D1 Background Information

Full Name
ubiquitin-conjugating enzyme E2D 1
References
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
  • UBE2D1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    UBE2D1 cDNA ORF Clone in Cloning Vector, Mouse MG51474-U
    UBE2D1 cDNA ORF Clone, Mouse, untagged MG51474-UT
    UBE2D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51474-ACGLN
    UBE2D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51474-ACG
    UBE2D1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51474-ANG
    UBE2D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51474-ACR
    UBE2D1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51474-ANR
    UBE2D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51474-CF
    UBE2D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51474-NF
    UBE2D1 cDNA ORF Clone, Mouse, C-His tag MG51474-CH
    UBE2D1 cDNA ORF Clone, Mouse, N-His tag MG51474-NH
    UBE2D1 cDNA ORF Clone, Mouse, C-HA tag MG51474-CY
    UBE2D1 cDNA ORF Clone, Mouse, N-HA tag MG51474-NY
    UBE2D1 cDNA ORF Clone, Mouse, C-Myc tag MG51474-CM
    UBE2D1 cDNA ORF Clone, Mouse, N-Myc tag MG51474-NM
    UBE2D1 qPCR Primer Pairs, Mouse MP201358

    UBE2D1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    UBE2D1 cDNA ORF Clone in Cloning Vector, Human HG11432-M
    UBE2D1 cDNA ORF Clone, Human, untagged HG11432-UT
    UBE2D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11432-ACG
    UBE2D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11432-ACGLN
    UBE2D1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11432-ANG
    UBE2D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11432-ACR
    UBE2D1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11432-ANR
    UBE2D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11432-CF
    UBE2D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11432-NF
    UBE2D1 cDNA ORF Clone, Human, C-His tag HG11432-CH
    UBE2D1 cDNA ORF Clone, Human, N-His tag HG11432-NH
    UBE2D1 cDNA ORF Clone, Human, C-HA tag HG11432-CY
    UBE2D1 cDNA ORF Clone, Human, N-HA tag HG11432-NY
    UBE2D1 cDNA ORF Clone, Human, C-Myc tag HG11432-CM
    UBE2D1 qPCR Primer Pairs, Human HP101309
    info info
    添加购物车成功! 添加购物车失败!