VBP1 cDNA ORF Clone, Human, C-His tag

Cat: HG15151-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All VBP1 Reagents

CRO Services

Product recommended


All VBP1 Reagents

VBP1 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
594 bp
Description
Full length Clone DNA of Human von Hippel-Lindau binding protein 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VBP1 cDNA ORF Clone, Human, C-His tag Alternative Names

HIBBJ46 cDNA ORF Clone, Human;PFD3 cDNA ORF Clone, Human;PFDN3 cDNA ORF Clone, Human;VBP-1 cDNA ORF Clone, Human

VBP1 Background Information

Full Name
von Hippel-Lindau binding protein 1

VBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51738-G
VBP1 cDNA ORF Clone, Mouse, untagged MG51738-UT
VBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51738-ACGLN
VBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51738-ACG
VBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51738-ANG
VBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51738-ACR
VBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51738-ANR
VBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51738-CF
VBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51738-NF
VBP1 cDNA ORF Clone, Mouse, C-His tag MG51738-CH
VBP1 cDNA ORF Clone, Mouse, N-His tag MG51738-NH
VBP1 cDNA ORF Clone, Mouse, C-HA tag MG51738-CY
VBP1 cDNA ORF Clone, Mouse, N-HA tag MG51738-NY
VBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51738-CM
VBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51738-NM
VBP1 qPCR Primer Pairs, Mouse MP201611

VBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VBP1 cDNA ORF Clone in Cloning Vector, Human HG15151-G
VBP1 cDNA ORF Clone, Human, untagged HG15151-UT
VBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15151-ACGLN
VBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15151-ACG
VBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15151-ANG
VBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15151-ACR
VBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15151-ANR
VBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15151-CF
VBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15151-NF
VBP1 cDNA ORF Clone, Human, N-His tag HG15151-NH
VBP1 cDNA ORF Clone, Human, C-HA tag HG15151-CY
VBP1 cDNA ORF Clone, Human, N-HA tag HG15151-NY
VBP1 cDNA ORF Clone, Human, C-Myc tag HG15151-CM
VBP1 cDNA ORF Clone, Human, N-Myc tag HG15151-NM
VBP1 qPCR Primer Pairs, Human HP103778
info info
添加购物车成功! 添加购物车失败!