B7-H4 cDNA ORF Clone, Human, N-His tag

Cat: HG10738-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All B7-H4 Reagents

CRO Services

Product recommended


All B7-H4 Reagents

B7-H4 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
849 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human V-set domain containing T cell activation inhibitor 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 0.87kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

B7-H4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B7-H4 cDNA ORF Clone, Human, N-His tag Validated Images

Rhesus CD3d/CD3 delta Gene Plasmid Map 5615

B7-H4 cDNA ORF Clone, Human, N-His tag Alternative Names

B7-H4 cDNA ORF Clone, Human;B7h.5 cDNA ORF Clone, Human;B7H4 cDNA ORF Clone, Human;B7S1 cDNA ORF Clone, Human;B7X cDNA ORF Clone, Human;PRO1291 cDNA ORF Clone, Human;VCTN1 cDNA ORF Clone, Human

B7-H4 Background Information

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
V-set domain containing T cell activation inhibitor 1
References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • B7-H4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    B7-H4 cDNA ORF Clone, Rhesus, untagged CG90901-UT

    B7-H4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    B7-H4 cDNA ORF Clone in Cloning Vector, Rat RG81070-G

    B7-H4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    B7-H4 cDNA ORF Clone in Cloning Vector, Mouse MG50017-M
    B7-H4 cDNA ORF Clone, Mouse, untagged MG50017-UT
    B7-H4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50017-ACGLN
    B7-H4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50017-ACG
    B7-H4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50017-ACR
    B7-H4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50017-CF
    B7-H4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50017-NF
    B7-H4 cDNA ORF Clone, Mouse, C-His tag MG50017-CH
    B7-H4 cDNA ORF Clone, Mouse, N-His tag MG50017-NH
    B7-H4 cDNA ORF Clone, Mouse, C-HA tag MG50017-CY
    B7-H4 cDNA ORF Clone, Mouse, N-HA tag MG50017-NY
    B7-H4 cDNA ORF Clone, Mouse, C-Myc tag MG50017-CM
    B7-H4 cDNA ORF Clone, Mouse, N-Myc tag MG50017-NM
    B7-H4 qPCR Primer Pairs, Mouse MP200017

    B7-H4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    B7-H4 cDNA ORF Clone in Cloning Vector, Human HG10738-M
    B7-H4 cDNA ORF Clone, Human, untagged HG10738-UT
    B7-H4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10738-ACG
    B7-H4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10738-ACGLN
    B7-H4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10738-ACR
    B7-H4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10738-CF
    B7-H4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10738-NF
    B7-H4 cDNA ORF Clone, Human, C-His tag HG10738-CH
    B7-H4 cDNA ORF Clone, Human, C-HA tag HG10738-CY
    B7-H4 cDNA ORF Clone, Human, N-HA tag HG10738-NY
    B7-H4 cDNA ORF Clone, Human, C-Myc tag HG10738-CM
    B7-H4 cDNA ORF Clone, Human, N-Myc tag HG10738-NM
    B7-H4 qPCR Primer Pairs, Human HP100674
    info info
    添加购物车成功! 添加购物车失败!