After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human VTI1A ORF mammalian expression plasmid, C-His tag

데이터시트리뷰관련제품프로토콜
Human VTI1A cDNA 클론 제품 정보
Gene_bank_ref_id:BC017052
cDNA 크기:612bp
cDNA 설명:Full length Clone DNA of Homo sapiens vesicle transport through interaction with t-SNAREs 1A with C terminal His tag.
유전자 동의어:MVti1, VTI1RP2, Vti1-rp2
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Cat No: HG14595-CH
정가:   (Save )
가격:      [How to order]
재고정보2-3 weeks
 배송안내
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".