After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Human WISP1 ORF mammalian expression plasmid, C-His tag

데이터시트리뷰관련제품프로토콜
Human WISP1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_003882.2
cDNA 크기:1104bp
cDNA 설명:Full length Clone DNA of Homo sapiens WNT1 inducible signaling pathway protein 1 with C terminal His tag.
유전자 동의어:CCN4, WISP1c, WISP1i, WISP1tc, WISP1
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

CCN4/Wnt-induced secreted protein 1 (WISP1) is a secreted, cysteine-rich, heparin-binding glycoprotein, belonging to the CCN (CTGF/CYR61/NOV) family of growth factors, and is involved in diverse biological functions such as cell growth, adhesion, migration, angiogenesis, tissue repair, and regulation of extracellular matrix. Members of the CCN family demonstrate high structural homology sharing four conserved cysteine-rich modular domains: a IGFBP (insulin-like growthfactor-binding) domain, a von Willebrand type C domain, a thrombospondin domain and a C-terminal cysteine -knot domain. WISP1 is a putative downstream effector of the Wnt/Frizzled pathway that mediates diversedevelopmental processes, was identified as an oncogene regulated by the Wnt-1-beta-catenin pathway. Thus may contributes to Wnt-1-mediated tumorigenesis and malignance. Expression of WISP1 in some cells results in transformation and tumorigenesis. WISP1 acts to block cell death at a late stage in the p53-mediated apoptosis pathway. It was reported that WISP1 interacts with sulfated glycoconjugates, decorin and biglycan in the ECM of connective tissue, and possibly prevents their inhibitory activity in tumor cell proliferation.

참고자료
  • Su F, et al. (2002) WISP-1 attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. Genes Dev. 16(1): 46-57.
  • Yanagita T, et al. (2007) Expression and physiological role of CCN4/Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes. FEBS J. 274(7): 1655-65.
  • Wang H, et al. (2009) Nitric oxide increases Wnt-induced secreted protein-1 (WISP-1/CCN4) expression and function in colitis. J Mol Med. 87(4): 435-45.
  • Venkatachalam K, et al. (2009) WISP1, a pro-mitogenic, pro-survival factor, mediates tumor necrosis factor-alpha (TNF-alpha)-stimulated cardiac fibroblast proliferation but inhibits TNF-alpha-induced cardiomyocyte death. J Biol Chem. 284(21): 14414-27.
  • Size / Price
    Cat No: HG10442-CH
    정가:   (Save )
    가격:      [How to order]
    재고정보
     배송안내
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".