Wnt4 cDNA ORF Clone, Human, untagged

Cat: HG10674-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Wnt4 Reagents
CRO Services
Product recommended

All Wnt4 Reagents
Wnt4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human wingless-type MMTV integration site family, member 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.06kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Wnt4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Wnt4 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Wnt4 cDNA ORF Clone, Human, untagged Alternative Names
SERKAL cDNA ORF Clone, Human;WNT-4 cDNA ORF Clone, Human
Wnt4 Background Information
Full Name
wingless-type MMTV integration site family, member 4

Wnt4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Wnt4 cDNA ORF Clone in Cloning Vector, Mouse MG50645-M
Wnt4 cDNA ORF Clone, Mouse, untagged MG50645-UT
Wnt4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50645-ACGLN
Wnt4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50645-ACG
Wnt4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50645-ACR
Wnt4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50645-CF
Wnt4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50645-NF
Wnt4 cDNA ORF Clone, Mouse, C-His tag MG50645-CH
Wnt4 cDNA ORF Clone, Mouse, N-His tag MG50645-NH
Wnt4 cDNA ORF Clone, Mouse, C-HA tag MG50645-CY
Wnt4 cDNA ORF Clone, Mouse, N-HA tag MG50645-NY
Wnt4 cDNA ORF Clone, Mouse, C-Myc tag MG50645-CM
Wnt4 cDNA ORF Clone, Mouse, N-Myc tag MG50645-NM
Wnt4 qPCR Primer Pairs, Mouse MP200624

Wnt4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Wnt4 cDNA ORF Clone in Cloning Vector, Human HG10674-M
Wnt4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10674-ACGLN
Wnt4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10674-ACG
Wnt4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10674-ACR
Wnt4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10674-CF
Wnt4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10674-NF
Wnt4 cDNA ORF Clone, Human, C-His tag HG10674-CH
Wnt4 cDNA ORF Clone, Human, N-His tag HG10674-NH
Wnt4 cDNA ORF Clone, Human, C-HA tag HG10674-CY
Wnt4 cDNA ORF Clone, Human, N-HA tag HG10674-NY
Wnt4 cDNA ORF Clone, Human, C-Myc tag HG10674-CM
Wnt4 cDNA ORF Clone, Human, N-Myc tag HG10674-NM
Wnt4 qPCR Primer Pairs, Human HP100640
info info
添加购物车成功! 添加购物车失败!