휴먼 XCL1 Gene ORF cDNA clone expression plasmid

  • Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 XCL1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002995.1
cDNA 크기:345bp
cDNA 설명:Full length Clone DNA of Homo sapiens chemokine (C motif) ligand 1.
유전자 동의어:LTN, ATAC, LPTN, SCM1, SCM-1, SCYC1, SCM-1a, XCL1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-XCL1
제한 사이트:KpnI + XbaI (6.1kb + 0.35kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with XCL1 qPCR primers for gene expression analysis, HP100639 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 XCL1 Gene Plasmid Map
Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Guzzo C, Fox JC, Miao H, Volkman BF, Lusso P. Structural Determinants for the Selective Anti-HIV-1 Activity of the All-β Alternative Conformer of XCL1. Kirchhoff F, ed. Journal of Virology. 2015;89(17):9061-9067.
  • Size / Price
    Cat No: HG10672-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".