Lymphotactin cDNA ORF Clone, Human, untagged

Cat: HG10672-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Lymphotactin Reagents
CRO Services
Product recommended

All Lymphotactin Reagents
Lymphotactin cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
345 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C motif) ligand 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.35kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Lymphotactin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lymphotactin cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Lymphotactin cDNA ORF Clone, Human, untagged Alternative Names
ATAC cDNA ORF Clone, Human;LPTN cDNA ORF Clone, Human;LTN cDNA ORF Clone, Human;SCM-1 cDNA ORF Clone, Human;SCM-1a cDNA ORF Clone, Human;SCM1 cDNA ORF Clone, Human;SCM1A cDNA ORF Clone, Human;SCYC1 cDNA ORF Clone, Human
Lymphotactin Background Information

This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
chemokine (C motif) ligand 1
References
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Guzzo C, Fox JC, Miao H, Volkman BF, Lusso P. Structural Determinants for the Selective Anti-HIV-1 Activity of the All-β Alternative Conformer of XCL1. Kirchhoff F, ed. Journal of Virology. 2015;89(17):9061-9067.
  • Lymphotactin cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Lymphotactin cDNA ORF Clone in Cloning Vector, Canine DG70096-G
    Lymphotactin cDNA ORF Clone, Canine, untagged DG70096-UT
    Lymphotactin Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70096-ACGLN
    Lymphotactin cDNA ORF Clone, Canine, C-GFPSpark® tag DG70096-ACG
    Lymphotactin cDNA ORF Clone, Canine, C-OFPSpark® tag DG70096-ACR
    Lymphotactin cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70096-CF
    Lymphotactin cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70096-NF
    Lymphotactin cDNA ORF Clone, Canine, C-His tag DG70096-CH
    Lymphotactin cDNA ORF Clone, Canine, N-His tag DG70096-NH
    Lymphotactin cDNA ORF Clone, Canine, C-HA tag DG70096-CY
    Lymphotactin cDNA ORF Clone, Canine, N-HA tag DG70096-NY
    Lymphotactin cDNA ORF Clone, Canine, C-Myc tag DG70096-CM
    Lymphotactin cDNA ORF Clone, Canine, N-Myc tag DG70096-NM

    Lymphotactin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Lymphotactin cDNA ORF Clone in Cloning Vector, Rhesus CG90079-G
    Lymphotactin cDNA ORF Clone, Rhesus, untagged CG90079-UT
    Lymphotactin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90079-ACG
    Lymphotactin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90079-ACGLN
    Lymphotactin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90079-ACR
    Lymphotactin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90079-CF
    Lymphotactin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90079-NF
    Lymphotactin cDNA ORF Clone, Rhesus, C-His tag CG90079-CH
    Lymphotactin cDNA ORF Clone, Rhesus, N-His tag CG90079-NH
    Lymphotactin cDNA ORF Clone, Rhesus, C-HA tag CG90079-CY
    Lymphotactin cDNA ORF Clone, Rhesus, N-HA tag CG90079-NY
    Lymphotactin cDNA ORF Clone, Rhesus, C-Myc tag CG90079-CM
    Lymphotactin cDNA ORF Clone, Rhesus, N-Myc tag CG90079-NM

    Lymphotactin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Lymphotactin cDNA ORF Clone in Cloning Vector, Mouse MG50677-M
    Lymphotactin cDNA ORF Clone, Mouse, untagged MG50677-UT
    Lymphotactin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50677-ACGLN
    Lymphotactin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50677-ACG
    Lymphotactin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50677-ACR
    Lymphotactin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50677-CF
    Lymphotactin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50677-NF
    Lymphotactin cDNA ORF Clone, Mouse, C-His tag MG50677-CH
    Lymphotactin cDNA ORF Clone, Mouse, N-His tag MG50677-NH
    Lymphotactin cDNA ORF Clone, Mouse, C-HA tag MG50677-CY
    Lymphotactin cDNA ORF Clone, Mouse, N-HA tag MG50677-NY
    Lymphotactin cDNA ORF Clone, Mouse, C-Myc tag MG50677-CM
    Lymphotactin cDNA ORF Clone, Mouse, N-Myc tag MG50677-NM
    Lymphotactin qPCR Primer Pairs, Mouse MP200656

    Lymphotactin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Lymphotactin cDNA ORF Clone in Cloning Vector, Human HG10672-M
    Lymphotactin cDNA ORF Clone, Human, C-GFPSpark® tag HG10672-ACG
    Lymphotactin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10672-ACGLN
    Lymphotactin cDNA ORF Clone, Human, C-OFPSpark® tag HG10672-ACR
    Lymphotactin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10672-CF
    Lymphotactin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10672-NF
    Lymphotactin cDNA ORF Clone, Human, C-His tag HG10672-CH
    Lymphotactin cDNA ORF Clone, Human, N-His tag HG10672-NH
    Lymphotactin cDNA ORF Clone, Human, C-HA tag HG10672-CY
    Lymphotactin cDNA ORF Clone, Human, N-HA tag HG10672-NY
    Lymphotactin cDNA ORF Clone, Human, C-Myc tag HG10672-CM
    Lymphotactin cDNA ORF Clone, Human, N-Myc tag HG10672-NM
    Lymphotactin qPCR Primer Pairs, Human HP100639
    info info
    添加购物车成功! 添加购物车失败!