ZWINT cDNA ORF Clone, Human, C-His tag

Cat: HG14599-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZWINT Reagents
CRO Services
Product recommended

All ZWINT Reagents
ZWINT cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Human ZW10 interactor, kinetochore protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZWINT cDNA ORF Clone, Human, C-His tag Alternative Names
HZwint-1 cDNA ORF Clone, Human;KNTC2AP cDNA ORF Clone, Human;SIP30 cDNA ORF Clone, Human;ZWINT1 cDNA ORF Clone, Human
ZWINT Background Information
Full Name
ZW10 interacting kinetochore protein

ZWINT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZWINT cDNA ORF Clone in Cloning Vector, Rat RG81028-U
ZWINT cDNA ORF Clone, Rat, untagged RG81028-UT
ZWINT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81028-ACG
ZWINT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81028-ACGLN
ZWINT cDNA ORF Clone, Rat, N-GFPSpark® tag RG81028-ANG
ZWINT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81028-ACR
ZWINT cDNA ORF Clone, Rat, N-OFPSpark® tag RG81028-ANR
ZWINT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81028-CF
ZWINT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81028-NF
ZWINT cDNA ORF Clone, Rat, C-His tag RG81028-CH
ZWINT cDNA ORF Clone, Rat, N-His tag RG81028-NH
ZWINT cDNA ORF Clone, Rat, C-HA tag RG81028-CY
ZWINT cDNA ORF Clone, Rat, N-HA tag RG81028-NY
ZWINT cDNA ORF Clone, Rat, C-Myc tag RG81028-CM
ZWINT cDNA ORF Clone, Rat, N-Myc tag RG81028-NM
ZWINT qPCR Primer Pairs, Rat RP300992

ZWINT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZWINT cDNA ORF Clone in Cloning Vector, Mouse MG53173-G
ZWINT cDNA ORF Clone, Mouse, untagged MG53173-UT
ZWINT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53173-ACGLN
ZWINT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53173-ACG
ZWINT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53173-ANG
ZWINT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53173-ACR
ZWINT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53173-ANR
ZWINT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53173-CF
ZWINT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53173-NF
ZWINT cDNA ORF Clone, Mouse, C-His tag MG53173-CH
ZWINT cDNA ORF Clone, Mouse, N-His tag MG53173-NH
ZWINT cDNA ORF Clone, Mouse, C-HA tag MG53173-CY
ZWINT cDNA ORF Clone, Mouse, N-HA tag MG53173-NY
ZWINT cDNA ORF Clone, Mouse, C-Myc tag MG53173-CM
ZWINT cDNA ORF Clone, Mouse, N-Myc tag MG53173-NM

ZWINT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZWINT cDNA ORF Clone in Cloning Vector, Human HG14599-G
ZWINT cDNA ORF Clone, Human, untagged HG14599-UT
ZWINT cDNA ORF Clone, Human, C-GFPSpark® tag HG14599-ACG
ZWINT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14599-ACGLN
ZWINT cDNA ORF Clone, Human, N-GFPSpark® tag HG14599-ANG
ZWINT cDNA ORF Clone, Human, C-OFPSpark® tag HG14599-ACR
ZWINT cDNA ORF Clone, Human, N-OFPSpark® tag HG14599-ANR
ZWINT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14599-CF
ZWINT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14599-NF
ZWINT cDNA ORF Clone, Human, N-His tag HG14599-NH
ZWINT cDNA ORF Clone, Human, C-HA tag HG14599-CY
ZWINT cDNA ORF Clone, Human, N-HA tag HG14599-NY
ZWINT cDNA ORF Clone, Human, C-Myc tag HG14599-CM
ZWINT cDNA ORF Clone, Human, N-Myc tag HG14599-NM
ZWINT qPCR Primer Pairs, Human HP103233
info info
添加购物车成功! 添加购物车失败!