After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 IL-8/Interleukin-8/CXCL8 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human CXCL8 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000584.2
cDNA 크기:300bp
cDNA 설명:Full length Clone DNA of Homo sapiens interleukin 8 with N terminal His tag.
유전자 동의어:CXCL8, GCP-1, GCP1, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1
:Human
벡터:pCMV3-SP-N-His
Plasmid:pCMV3-His-IL8
제한 사이트:KpnI + XbaI (6kb + 0.33kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human CXCL8 Gene Plasmid Map
Human interleukin 8 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

참고자료
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • Size / Price
    Cat No: HG10098-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human interleukin 8 ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".