After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human NRG1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013957.3
cDNA 크기:1914bp
cDNA 설명:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
유전자 동의어:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10658-ACG288840
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10658-ACR288840
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10658-CF253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-His 태그HG10658-CH253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10658-CM253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10658-CY253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone in cloning vectorHG10658-M88420
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10658-NF253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, N-His 태그HG10658-NH253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10658-NM253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10658-NY253470
휴먼 NRG1/Neuregulin 1 transcript variant HRG-beta2 Gene ORF cDNA clone expression plasmidHG10658-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

참고자료
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Cat No: HG10658-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".