After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
RSV RSV-G cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:897bp
cDNA 설명:Full length Clone DNA of Human RSV (subtype A, strain A2) glycoprotein G / RSV-G with N terminal His tag.
유전자 동의어:G, HRSVgp07
:RSV
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03423.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His 태그 on other vectors
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40038-ACG383160
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40038-ACR383160
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag 태그VG40038-CF347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His 태그VG40038-CH347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc 태그VG40038-CM347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA 태그VG40038-CY347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-G112000
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag 태그VG40038-NF347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His 태그VG40038-NH347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40038-NM347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA 태그VG40038-NY347790
호흡기 세포융합 바이러스 (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

참고자료
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Cat No: VG40038-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".