After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
RSV RSV-F cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:1725bp
cDNA 설명:Full length Clone DNA of Human RSV (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F with N terminal His tag.
유전자 동의어:F, HRSVgp08
:RSV
벡터:pCMV3-SP-N-His
Plasmid:pCMV3-His-RSV-F(A-RSS2)
제한 사이트:KpnI + XbaI (6kb + 1.74kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P11209.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
RSV RSV-F Gene Plasmid Map
Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His 태그 on other vectors
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40037-ACG406730
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40037-ACR406730
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag 태그VG40037-CF371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His 태그VG40037-CH371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc 태그VG40037-CM371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA 태그VG40037-CY371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-G135580
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag 태그VG40037-NF371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His 태그VG40037-NH371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40037-NM371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA 태그VG40037-NY371370
호흡기 세포융합 바이러스 (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-UT371370
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

참고자료
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Cat No: VG40037-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
    • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".