After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag

데이터시트리뷰관련제품프로토콜
 HA cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:1695bp
cDNA 설명:Full length Clone DNA of Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin with C terminal His tag.
유전자 동의어:Hemagglutinin, HA
:H4N2
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADN78261.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag on other vectors
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40390-ACG$345
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40390-ACR$345
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tagVG40390-CF$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40390-CH$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40390-CM$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40390-CY$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40390-G$115
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40390-NF$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40390-NH$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40390-NM$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40390-NY$315
Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40390-UT$315
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40390-CH
정가:   (Save )
가격:      [How to order]
재고정보2-3 weeks배송안내
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".