After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
H4N6 NA cDNA 클론 제품 정보
Gene_bank_ref_id:CY011038.1
cDNA 크기:1413bp
cDNA 설명:Full length Clone DNA of Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase with N terminal His tag.
유전자 동의어:Neuraminidase, NA
:H4N6
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-His 태그 on other vectors
인플루엔자 A H4N6 (A/mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-GFPSpark 태그VG40235-ACG383160
인플루엔자 A H4N6 (A/mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40235-ACR383160
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-Flag 태그VG40235-CF347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-His 태그VG40235-CH347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-Myc 태그VG40235-CM347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, C-HA 태그VG40235-CY347790
인플루엔자 A H4N6 (A/mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid (Codon Optimized)VG40235-G112000
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-Flag 태그VG40235-NF347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-His 태그VG40235-NH347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-Myc 태그VG40235-NM347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) ORF mammalian expression plasmid, N-HA 태그VG40235-NY347790
인플루엔자 A H4N6 (mallard/Ohio/657/2002) 뉴라미니다아제(NA) natural ORF mammalian expression plasmidVG40235-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

참고자료
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Cat No: VG40235-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".