Text Size:AAA

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready

데이터시트리뷰관련제품프로토콜
H5N1 HA cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:1701bp
cDNA 설명:Full length Clone DNA of Influenza A H5N1 (A/Xinjiang/1/2006) HA with N terminal His tag.
유전자 동의어:HA1, Hemagglutinin
:H5N1
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACJ68614.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready on other vectors
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40004-ACG406730
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40004-ACR406730
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmidVG40004-C371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40004-CF371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40004-CH371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40004-CM371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40004-CY371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Flag tag, expression readyVG40004-NF371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40004-NH371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40004-NM371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40004-NY371370
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40004-UT371370
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40004-NH
정가:   (Save )
가격:      [How to order]
재고정보2-3 weeks배송안내
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".