인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    H5N1 HA cDNA 클론 제품 정보
    Gene_bank_ref_id:
    cDNA 크기:1695bp
    cDNA 설명:Full length Clone DNA of Influenza A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hemagglutinin with N terminal His tag.
    유전자 동의어:Hemagglutinin, HA
    :H5N1
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABF93441.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His 태그 on other vectors
    인플루엔자 A H5N1 (A/bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40117-ACG406730
    인플루엔자 A H5N1 (A/bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40117-ACR406730
    인플루엔자 A H5N1 (A/bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) ORF mammalian expression plasmid (Codon Optimized)VG40117-C371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag 태그VG40117-CF371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His 태그VG40117-CH371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc 태그VG40117-CM371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA 태그VG40117-CY371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag 태그VG40117-NF371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His 태그VG40117-NH371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40117-NM371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA 태그VG40117-NY371370
    인플루엔자 A H5N1 (bar-headed goose/Qinghai/1A/2005) 헤마글루티닌(HA) ORF mammalian expression plasmid (Codon Optimized)VG40117-UT371370
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

    참고자료
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Cat No: VG40117-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".