After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

데이터시트리뷰관련제품프로토콜
H5N1 HA cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:1704bp
cDNA 설명:Full length Clone DNA of Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin with C terminal HA tag.
유전자 동의어:Hemagglutinin, HA
:H5N1
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with BAD89305.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40088-ACG406730
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40088-ACR406730
Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40088-C465680
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40088-CF371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40088-CH371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40088-CM371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40088-CY371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40088-NF371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40088-NH371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40088-NM371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40088-NY371370
Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40088-UT371370
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".