휴먼 KLRG1 Gene ORF cDNA clone expression plasmid

  • Human KLRG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 KLRG1 cDNA 클론 제품 정보
cDNA 크기:
cDNA 설명:
유전자 동의어:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with KLRG1 qPCR primers for gene expression analysis, HP104813 )
휴먼 KLRG1 Gene Plasmid Map
Human KLRG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".