LIGHT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50980-G-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LIGHT Reagents
CRO Services

All LIGHT Reagents
LIGHT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
720 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 14 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LIGHT cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIGHT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse TNFSF14/LIGHT/CD258 Gene Expression validated Image 2496
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
LIGHT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
HVEM-L cDNA ORF Clone, Mouse;HVEML cDNA ORF Clone, Mouse;LIGHT cDNA ORF Clone, Mouse;LTg cDNA ORF Clone, Mouse;Ly113 cDNA ORF Clone, Mouse
LIGHT Background Information

LIGHT, also known as TNFSF14 or CD258, is a newly identified member of the TNF superfamily (TNFSF14) that is expressed by activated T lymphocytes, monocytes, granulocytes, spleen cells, and immature dendritic cells. TNFSF14 / LIGHT / CD258 is a type II transmembrane protein that is known to bind 2 membrane-bound TNFSF signaling receptors: HVEM, which is predominantly expressed by T cells, and lymphotoxin β receptor (LTβR), which is expressed by stromal cells and nonlymphoid hematopoietic cells. TNFSF14 / LIGHT / CD258 also binds to a soluble nonsignaling receptor, decoy receptor 3 (DcR3), which can modulate the function of LIGHT in vivo. TNFSF14 / LIGHT / CD258 can also costimulate T cell responses via HVEM, which is constitutively expressed in most lymphocyte subpopulations, including CD4+ and CD8+ T cells. In addition, TNFSF14 / LIGHT / CD258 has been shown to suppress tumor formation in vivo and to induce tumor cell apoptosis via the up-regulation of intercellular adhesion molecule 1 and an increased lymphocyte adhesion to cancer cells. Thus, TNFSF14 / LIGHT / CD258 is being actively investigated as a possible basis for cancer treatment.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 14
Research Areas
References
  • Ogawa T, et al. (2010) CXCR3 binding chemokine and TNFSF14 over expression in bladder urothelium of patients with ulcerative interstitial cystitis. J Urol. 183(3): 1206-12.
  • Kanodia S, et al. (2010) Expression of LIGHT/TNFSF14 combined with vaccination against human papillomavirus Type 16 E7 induces significant tumor regression. Cancer Res. 70(10): 3955-64.
  • Hosokawa Y, et al. (2010) TNFSF14 coordinately enhances CXCL10 and CXCL11 productions from IFN-gamma-stimulated human gingival fibroblasts. Mol Immunol. 47(4): 666-70.
  • LIGHT cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    LIGHT cDNA ORF Clone in Cloning Vector, Cynomolgus CG90090-G
    LIGHT cDNA ORF Clone, Cynomolgus, untagged CG90090-UT
    LIGHT Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90090-ACGLN
    LIGHT cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90090-ACG
    LIGHT cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90090-ACR
    LIGHT cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90090-CF
    LIGHT cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90090-NF
    LIGHT cDNA ORF Clone, Cynomolgus, C-His tag CG90090-CH
    LIGHT cDNA ORF Clone, Cynomolgus, N-His tag CG90090-NH
    LIGHT cDNA ORF Clone, Cynomolgus, C-HA tag CG90090-CY
    LIGHT cDNA ORF Clone, Cynomolgus, N-HA tag CG90090-NY
    LIGHT cDNA ORF Clone, Cynomolgus, C-Myc tag CG90090-CM
    LIGHT cDNA ORF Clone, Cynomolgus, N-Myc tag CG90090-NM

    LIGHT cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LIGHT cDNA ORF Clone in Cloning Vector, Rat RG80175-G
    LIGHT cDNA ORF Clone, Rat, untagged RG80175-UT
    LIGHT cDNA ORF Clone, Rat, C-GFPSpark® tag RG80175-ACG
    LIGHT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80175-ACGLN
    LIGHT cDNA ORF Clone, Rat, C-OFPSpark® tag RG80175-ACR
    LIGHT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80175-CF
    LIGHT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80175-NF
    LIGHT cDNA ORF Clone, Rat, C-His tag RG80175-CH
    LIGHT cDNA ORF Clone, Rat, N-His tag RG80175-NH
    LIGHT cDNA ORF Clone, Rat, C-HA tag RG80175-CY
    LIGHT cDNA ORF Clone, Rat, N-HA tag RG80175-NY
    LIGHT cDNA ORF Clone, Rat, C-Myc tag RG80175-CM
    LIGHT cDNA ORF Clone, Rat, N-Myc tag RG80175-NM
    LIGHT qPCR Primer Pairs, Rat RP300168

    LIGHT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LIGHT cDNA ORF Clone in Cloning Vector, Mouse MG50980-G
    LIGHT cDNA ORF Clone, Mouse, untagged MG50980-UT
    LIGHT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50980-ACGLN
    LIGHT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50980-ACG
    LIGHT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50980-ACR
    LIGHT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50980-CF
    LIGHT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50980-NF
    LIGHT cDNA ORF Clone, Mouse, C-His tag MG50980-CH
    LIGHT cDNA ORF Clone, Mouse, N-His tag MG50980-NH
    LIGHT cDNA ORF Clone, Mouse, C-HA tag MG50980-CY
    LIGHT cDNA ORF Clone, Mouse, N-HA tag MG50980-NY
    LIGHT cDNA ORF Clone, Mouse, C-Myc tag MG50980-CM
    LIGHT cDNA ORF Clone, Mouse, N-Myc tag MG50980-NM
    LIGHT qPCR Primer Pairs, Mouse MP200948

    LIGHT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LIGHT cDNA ORF Clone in Cloning Vector, Human HG10386-M
    LIGHT cDNA ORF Clone, Human, untagged HG10386-UT
    LIGHT cDNA ORF Clone, Human, C-GFPSpark® tag HG10386-ACG
    LIGHT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10386-ACGLN
    LIGHT cDNA ORF Clone, Human, N-GFPSpark® tag HG10386-ANG
    LIGHT cDNA ORF Clone, Human, C-OFPSpark® tag HG10386-ACR
    LIGHT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10386-CF
    LIGHT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10386-NF
    LIGHT cDNA ORF Clone, Human, C-His tag HG10386-CH
    LIGHT cDNA ORF Clone, Human, N-His tag HG10386-NH
    LIGHT cDNA ORF Clone, Human, C-HA tag HG10386-CY
    LIGHT cDNA ORF Clone, Human, N-HA tag HG10386-NY
    LIGHT cDNA ORF Clone, Human, C-Myc tag HG10386-CM
    LIGHT cDNA ORF Clone, Human, N-Myc tag HG10386-NM
    LIGHT qPCR Primer Pairs, Human HP100420
    info info
    添加购物车成功! 添加购物车失败!