After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
MERS-CoV CoV-orf5 cDNA 클론 제품 정보
Gene_bank_ref_id:JX869059.2
cDNA 크기:324bp
cDNA 설명:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf5 with C terminal HA tag.
유전자 동의어:CoV-orf5
:MERS-CoV
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank AFS88940 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA 태그 on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-GFPSpark 태그VG40086-ACG383156
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40086-ACR383156
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-GFPSpark 태그VG40086-ANG383156
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40086-ANR383156
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Flag 태그VG40086-CF347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-His 태그VG40086-CH347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Myc 태그VG40086-CM347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA 태그VG40086-CY347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid (Codon Optimized)VG40086-G111999
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Flag 태그VG40086-NF347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His 태그VG40086-NH347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Myc 태그VG40086-NM347787
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-HA 태그VG40086-NY347787
MERS-CoV (NCoV / Novel coronavirus) orf5 natural ORF mammalian expression plasmidVG40086-UT347787
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40086-CY
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".