After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
MERS-CoV CoV-orf5 cDNA 클론 제품 정보
Gene_bank_ref_id:JX869059.2
cDNA 크기:324bp
cDNA 설명:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf5 with N terminal His tag.
유전자 동의어:CoV-orf5
:MERS-CoV
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank AFS88940 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His 태그 on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-GFPSpark 태그VG40086-ACG383160
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40086-ACR383160
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-GFPSpark 태그VG40086-ANG383160
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40086-ANR383160
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Flag 태그VG40086-CF347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-His 태그VG40086-CH347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Myc 태그VG40086-CM347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA 태그VG40086-CY347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid (Codon Optimized)VG40086-G112000
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Flag 태그VG40086-NF347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His 태그VG40086-NH347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Myc 태그VG40086-NM347790
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-HA 태그VG40086-NY347790
MERS-CoV (NCoV / Novel coronavirus) orf5 natural ORF mammalian expression plasmidVG40086-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40086-NH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".