MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag

Cat: VG40084-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CoV-orf4b Reagents

CRO Services

Product recommended


All CoV-orf4b Reagents

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag General Information

Gene

Species
MERS-CoV
NCBI Ref Seq
RefSeq ORF Size
783 bp
Sequence Description
Identical with the Gene Bank AFS88939.1.
Description
Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.78kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV-orf4b cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

CoV-orf4b Background Information

CoV-orf4b cDNA ORF Clone, MERS-CoV, Related Products

Product Name Catalog#(PDF)
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid (Codon Optimized) VG40084-G
MERS-CoV (NCoV / Novel coronavirus) orf4b natural ORF mammalian expression plasmid VG40084-UT
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-GFPSpark tag VG40084-ACG
MERS-CoV (NCoV / Novel coronavirus) orf4b Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40084-ACGLN
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-GFPSpark tag VG40084-ANG
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40084-ACR
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40084-ANR
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Flag tag VG40084-CF
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Flag tag VG40084-NF
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-His tag VG40084-CH
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His tag VG40084-NH
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-HA tag VG40084-NY
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Myc tag VG40084-CM
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Myc tag VG40084-NM
info info
添加购物车成功! 添加购物车失败!