Text Size:AAA

휴먼 MAP2 Gene ORF cDNA clone expression plasmid, C-Flag 태그

Human METAP2 cDNA 클론 제품 정보
cDNA 크기:1437bp
cDNA 설명:Full length Clone DNA of Homo sapiens methionyl aminopeptidase 2 with Flag tag.
유전자 동의어:METAP2, p67, MAP2, MNPEP, p67eIF2
제한 사이트:KpnI + XhoI (5.4kb + 1.49kb)
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".