AASDHPPT cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51658-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AASDHPPT Reagents
CRO Services
Product recommended

All AASDHPPT Reagents
AASDHPPT cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Mouse aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AASDHPPT cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2010309J24Rik cDNA ORF Clone, Mouse;2810407B07Rik cDNA ORF Clone, Mouse;AASD-PPT cDNA ORF Clone, Mouse;CGI-80 cDNA ORF Clone, Mouse;LYS2 cDNA ORF Clone, Mouse;LYS5 cDNA ORF Clone, Mouse
AASDHPPT Background Information
Full Name
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase

AASDHPPT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AASDHPPT cDNA ORF Clone in Cloning Vector, Mouse MG51658-G
AASDHPPT cDNA ORF Clone, Mouse, untagged MG51658-UT
AASDHPPT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51658-ACGLN
AASDHPPT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51658-ACG
AASDHPPT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51658-ANG
AASDHPPT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51658-ACR
AASDHPPT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51658-ANR
AASDHPPT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51658-CF
AASDHPPT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51658-NF
AASDHPPT cDNA ORF Clone, Mouse, C-His tag MG51658-CH
AASDHPPT cDNA ORF Clone, Mouse, N-His tag MG51658-NH
AASDHPPT cDNA ORF Clone, Mouse, C-HA tag MG51658-CY
AASDHPPT cDNA ORF Clone, Mouse, N-HA tag MG51658-NY
AASDHPPT cDNA ORF Clone, Mouse, N-Myc tag MG51658-NM
AASDHPPT qPCR Primer Pairs, Mouse MP201531

AASDHPPT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AASDHPPT cDNA ORF Clone in Cloning Vector, Human HG16516-G
AASDHPPT cDNA ORF Clone, Human, untagged HG16516-UT
AASDHPPT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16516-ACGLN
AASDHPPT cDNA ORF Clone, Human, C-GFPSpark® tag HG16516-ACG
AASDHPPT cDNA ORF Clone, Human, N-GFPSpark® tag HG16516-ANG
AASDHPPT cDNA ORF Clone, Human, C-OFPSpark® tag HG16516-ACR
AASDHPPT cDNA ORF Clone, Human, N-OFPSpark® tag HG16516-ANR
AASDHPPT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16516-CF
AASDHPPT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16516-NF
AASDHPPT cDNA ORF Clone, Human, C-His tag HG16516-CH
AASDHPPT cDNA ORF Clone, Human, N-His tag HG16516-NH
AASDHPPT cDNA ORF Clone, Human, C-HA tag HG16516-CY
AASDHPPT cDNA ORF Clone, Human, N-HA tag HG16516-NY
AASDHPPT cDNA ORF Clone, Human, C-Myc tag HG16516-CM
AASDHPPT cDNA ORF Clone, Human, N-Myc tag HG16516-NM
info info
添加购物车成功! 添加购物车失败!