ABHD17A cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

ABHD17A cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Mouse abhydrolase domain containing 17A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABHD17A cDNA ORF Clone, Mouse, N-His tag: Alternative Names

1700013O15Rik cDNA ORF Clone, Mouse; BC005632 cDNA ORF Clone, Mouse; D10Bwg1364e cDNA ORF Clone, Mouse; Fam108a cDNA ORF Clone, Mouse

ABHD17A Background Information

Full Name
abhydrolase domain containing 17A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait