Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, untagged

Cat: MG50274-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Tartrate Resistant Acid Phosphatase Reagents
CRO Services
Product recommended

All Tartrate Resistant Acid Phosphatase Reagents
Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
984 bp
Description
Full length Clone DNA of Mouse acid phosphatase 5, tartrate resistant.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, untagged Alternative Names
TRACP cDNA ORF Clone, Mouse;TRAP cDNA ORF Clone, Mouse
Tartrate Resistant Acid Phosphatase Background Information

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

Full Name
acid phosphatase 5, tartrate resistant
References
  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone in Cloning Vector, Mouse MG50274-M
    Tartrate Resistant Acid Phosphatase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50274-ACGLN
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50274-ACG
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50274-ACR
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50274-CF
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50274-NF
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-His tag MG50274-CH
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, N-His tag MG50274-NH
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-HA tag MG50274-CY
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, N-HA tag MG50274-NY
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, C-Myc tag MG50274-CM
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Mouse, N-Myc tag MG50274-NM
    Tartrate Resistant Acid Phosphatase qPCR Primer Pairs, Mouse MP200298

    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone in Cloning Vector, Human HG10550-M
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, untagged HG10550-UT
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-GFPSpark® tag HG10550-ACG
    Tartrate Resistant Acid Phosphatase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10550-ACGLN
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-OFPSpark® tag HG10550-ACR
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10550-CF
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10550-NF
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-His tag HG10550-CH
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, N-His tag HG10550-NH
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-HA tag HG10550-CY
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, N-HA tag HG10550-NY
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, C-Myc tag HG10550-CM
    Tartrate Resistant Acid Phosphatase cDNA ORF Clone, Human, N-Myc tag HG10550-NM
    Tartrate Resistant Acid Phosphatase qPCR Primer Pairs, Human HP100564
    info info
    添加购物车成功! 添加购物车失败!