ACTC1 cDNA ORF Clone, Mouse, untagged

Cat: MG51355-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACTC1 Reagents
CRO Services
Product recommended

All ACTC1 Reagents
ACTC1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Mouse actin, alpha, cardiac muscle 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACTC1 cDNA ORF Clone, Mouse, untagged Alternative Names
Actc-1 cDNA ORF Clone, Mouse
ACTC1 Background Information
Full Name
actin, alpha, cardiac muscle 1

ACTC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACTC1 cDNA ORF Clone in Cloning Vector, Rat RG80613-U
ACTC1 cDNA ORF Clone, Rat, untagged RG80613-UT
ACTC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80613-ACG
ACTC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80613-ACGLN
ACTC1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80613-ANG
ACTC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80613-ACR
ACTC1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80613-ANR
ACTC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80613-CF
ACTC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80613-NF
ACTC1 cDNA ORF Clone, Rat, C-His tag RG80613-CH
ACTC1 cDNA ORF Clone, Rat, N-His tag RG80613-NH
ACTC1 cDNA ORF Clone, Rat, C-HA tag RG80613-CY
ACTC1 cDNA ORF Clone, Rat, N-HA tag RG80613-NY
ACTC1 cDNA ORF Clone, Rat, C-Myc tag RG80613-CM
ACTC1 cDNA ORF Clone, Rat, N-Myc tag RG80613-NM
ACTC1 qPCR Primer Pairs, Rat RP300577

ACTC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACTC1 cDNA ORF Clone in Cloning Vector, Mouse MG51355-U
ACTC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51355-ACGLN
ACTC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51355-ACG
ACTC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51355-ANG
ACTC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51355-ACR
ACTC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51355-ANR
ACTC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51355-CF
ACTC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51355-NF
ACTC1 cDNA ORF Clone, Mouse, C-His tag MG51355-CH
ACTC1 cDNA ORF Clone, Mouse, N-His tag MG51355-NH
ACTC1 cDNA ORF Clone, Mouse, C-HA tag MG51355-CY
ACTC1 cDNA ORF Clone, Mouse, N-HA tag MG51355-NY
ACTC1 cDNA ORF Clone, Mouse, C-Myc tag MG51355-CM
ACTC1 cDNA ORF Clone, Mouse, N-Myc tag MG51355-NM
ACTC1 qPCR Primer Pairs, Mouse MP201232

ACTC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACTC1 cDNA ORF Clone in Cloning Vector, Human HG10960-M
ACTC1 cDNA ORF Clone, Human, untagged HG10960-UT
ACTC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10960-ACGLN
ACTC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10960-ACG
ACTC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10960-ANG
ACTC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10960-ACR
ACTC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10960-ANR
ACTC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10960-CF
ACTC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10960-NF
ACTC1 cDNA ORF Clone, Human, C-His tag HG10960-CH
ACTC1 cDNA ORF Clone, Human, N-His tag HG10960-NH
ACTC1 cDNA ORF Clone, Human, C-HA tag HG10960-CY
ACTC1 cDNA ORF Clone, Human, N-HA tag HG10960-NY
ACTC1 cDNA ORF Clone, Human, C-Myc tag HG10960-CM
ACTC1 cDNA ORF Clone, Human, N-Myc tag HG10960-NM
ACTC1 qPCR Primer Pairs, Human HP100836
info info
添加购物车成功! 添加购物车失败!