쥐 Adenosine Receptor A2a Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
     ADORA2A cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_009630.2
    cDNA 크기:1233bp
    cDNA 설명:Full length Clone DNA of Mus musculus adenosine A2a receptor with N terminal Myc tag.
    유전자 동의어:A2aR, A2AAR, AA2AR
    :Mouse
    벡터:pCMV3-SP-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ADORA2A qPCR primers for gene expression analysis, MP202457 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    참고자료
  • Alchera E, Imarisio C, Mandili G, et al. Pharmacological Preconditioning by Adenosine A2a Receptor Stimulation: Features of the Protected Liver Cell Phenotype. BioMed Research International. 2015;2015:286746.
  • Size / Price
    Cat No: MG52586-NM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".