C1orf80 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52585-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All C1orf80 Reagents

CRO Services

Product recommended


All C1orf80 Reagents

C1orf80 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Mouse axin interactor, dorsalization associated with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1orf80 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

2610208M17Rik cDNA ORF Clone, Mouse;BC004835 cDNA ORF Clone, Mouse

C1orf80 Background Information

Full Name
axin interactor, dorsalization associated

C1orf80 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C1orf80 cDNA ORF Clone in Cloning Vector, Mouse MG52585-G
C1orf80 cDNA ORF Clone, Mouse, untagged MG52585-UT
C1orf80 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52585-ACGLN
C1orf80 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52585-ACG
C1orf80 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52585-ANG
C1orf80 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52585-ACR
C1orf80 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52585-ANR
C1orf80 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52585-CF
C1orf80 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52585-NF
C1orf80 cDNA ORF Clone, Mouse, C-His tag MG52585-CH
C1orf80 cDNA ORF Clone, Mouse, N-His tag MG52585-NH
C1orf80 cDNA ORF Clone, Mouse, C-HA tag MG52585-CY
C1orf80 cDNA ORF Clone, Mouse, N-HA tag MG52585-NY
C1orf80 cDNA ORF Clone, Mouse, C-Myc tag MG52585-CM
C1orf80 qPCR Primer Pairs, Mouse MP202456

C1orf80 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C1orf80 cDNA ORF Clone in Cloning Vector, Human HG11513-M
C1orf80 cDNA ORF Clone, Human, untagged HG11513-UT
C1orf80 cDNA ORF Clone, Human, C-GFPSpark® tag HG11513-ACG
C1orf80 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11513-ACGLN
C1orf80 cDNA ORF Clone, Human, N-GFPSpark® tag HG11513-ANG
C1orf80 cDNA ORF Clone, Human, C-OFPSpark® tag HG11513-ACR
C1orf80 cDNA ORF Clone, Human, N-OFPSpark® tag HG11513-ANR
C1orf80 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11513-CF
C1orf80 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11513-NF
C1orf80 cDNA ORF Clone, Human, C-His tag HG11513-CH
C1orf80 cDNA ORF Clone, Human, N-His tag HG11513-NH
C1orf80 cDNA ORF Clone, Human, C-HA tag HG11513-CY
C1orf80 cDNA ORF Clone, Human, N-HA tag HG11513-NY
C1orf80 cDNA ORF Clone, Human, C-Myc tag HG11513-CM
C1orf80 cDNA ORF Clone, Human, N-Myc tag HG11513-NM
C1orf80 qPCR Primer Pairs, Human HP101384
info info
添加购物车成功! 添加购物车失败!